Coeficientes alométricos das partes e dos órgãos de codornas de corte mantidas em diferentes ambientes térmicos / Allometric coefficients of the cuts and organs of meat quail kept in different thermal environments

Objetivou-se comparar os coeficientes alométricos (b) que descrevem o crescimento das partes e dos órgãos de codornas de corte mantidas em diferentes ambientes térmicos. Foram utilizadas 300 codornas distribuídas em delineamento inteiramente ao acaso, com dois tratamentos (ambiente climatizado, AC) com temperatura de 26ºC e ambiente sem climatização (ASC, 32oC) e seis repetições de 25 aves. Ajustaram-se equações alométricas em função do peso em jejum (PJ) para as variáveis: peso do peito (PPEI), coxa (PCX), sobrecoxa (PSCX), asa (PASA), coração (PCOR), fígado (PFÍG), moela (PMOE) e intestino (PINT). Para comparar os "b" das partes e dos órgãos das aves mantidas nos diferentes ambientes, realizaram-se testes de paralelismo. Não houve diferença entre os "b" em nenhuma das partes e dos órgãos das codornas mantidos no ambiente AC ou no ASC. Observou-se que os PPEI e os PSCX apresentaram crescimento heterogônico positivo (b>1), os PCX crescimento isogônico (b=1), os PASA e os órgãos crescimento heterogônico negativo (b<1) em relação ao PJ. Os "b" que descrevem o crescimento das partes e dos órgãos de codornas de corte mantidas nos diferentes ambientes não são influenciados. O peso do peito e o da sobrecoxa apresentaram crescimento tardio, a asa e os órgãos (coração, fígado, moela e intestino) crescimento precoce, e o peso da coxa apresentou crescimento proporcional em relação ao peso em jejum.(AU)

This study was carried out to compare the allometric coefficients (b) that describe the cuts and organs' growth of quails kept in different thermal environments. Three hundred meat quails were distributed in a completely randomized design with two treatments (climatized environment (CE) with 26°C of ambient temperature and environment without climatization (EWC, 32°C)) and six replicates of 25 birds. Allometric equations based on weekly fasting weight (WF) for the breast weight (BW), thigh (TW), drumstick (DW), wing (WW), heart (HW), liver (LW) gizzard (GW) and intestine (IW) were performed. To compare the "b" of the cuts and organs parallelism tests were carried out. There was no difference between the "b" in any cuts and organs of quails kept in CE or EWC environments. We observed that the BW and DW showed positive heterogonic growth (b>1), TW isogonic growth (b=1), and WW and organs negative heterogonic growth (b<1) in relation PJ. The "b" that describes the growth of cuts and organs of quails kept in CE or EWC environments are not affected. The breast and drumstick presented late growth, the wing and the organs early growth, and the thigh showed a proportional increase with the fasting weight.(AU)

Emergence of Trichosporon mycotoxinivorans (Apiotrichum mycotoxinivorans) invasive infections in Latin America

We report the first two cases of Trichosporon mycotoxinivorans infections in Latin America. We also conducted a literature review and a microbiological investigation, including that of clinical and environmental isolates. A 30-year-old man with chronic renal failure had disseminated infection after dialysis and a 15-year-old boy with cystic fibrosis (CF) had pulmonary exacerbations with positive respiratory samples. A review of the relevant literature revealed that deep-seated infections were related to immunosuppression or invasive devices, while most of the CF patients showed a decline in lung function after positive cultures. Phylogenetic analyses revealed three distinct circulating genotypes. MALDI-TOF mass spectrometry analysis showed similar spectral profiles and correctly identified all strains/isolates. Biofilm production was documented in a bloodstream isolate and biofilm-producing cells showed high minimum inhibitory concentrations against antifungals.

Fenologia e prospecção fitoquímica do jaborandi (Pilocarpus microphyllus Stapf ex Holmes) / Phenology and phytochemical prospection of Jaborandi (Pilocarpus microphyllus Stapf ex Holmes)

RESUMO O estudo fenológico tem como finalidade determinar o ritmo sazonal dos eventos do ciclo de vida da planta, como floração e frutificação. Estes eventos são determinados por uma série de fatores, como: alternância de períodos chuvosos ou não chuvosos, intensidade da radiação solar, entre outros. A fitoquímica tem por objetivos conhecer os constituintes químicos de espécies vegetais ou avaliar sua presença. O presente trabalho teve como objetivo realizar a caracterização fenológica e a prospecção fitoquímica de folhas de jaborandi. A área de estudo para a avaliação do material vegetal foi o Banco Ativo de Germoplasma de Jaborandi da Embrapa Amazônia Oriental, situada no município de Belém-PA. Os acessos escolhidos foram: Merck, cultivado a pleno sol e à sombra; Japonês e Bonal 4, cultivados a pleno sol. Os registros foram realizados diariamente por um período de 28 meses correspondendo a agosto de 2010 a dezembro de 2012, de cinco plantas/acesso e organizados para demonstração mensal, através de fichas com a numeração respectiva das plantas, com registro de presença ou ausência das fenofases, floração e frutificação. A determinação do peso seco das amostras coletadas dos acessos foi realizada no Laboratório de Agroindústria da Embrapa Amazônia Oriental, onde, após a triagem e remoção das impurezas, as folhas foram cortadas, pesadas, colocadas em bandejas de inox e secas em estufa com circulação mecânica (FANEM 320-SE), à temperatura de 45º C por 120 h. Em seguida, as amostras foram pesadas, trituradas e acondicionadas em sacos plásticos devidamente identificados e guardados sob refrigeração à temperatura de 10º C até o uso. Os extratos das plantas foram preparados utilizando-se 100 g de folhas secas de cada acesso, triturados e submetidos à extração hidroalcoólica (etanol 80%) em banho-maria sob refluxo, por aproximadamente 4 horas. Os extratos foram armazenados protegidos da luz na geladeira até o momento das análises. Foi analisada a presença das seguintes classes de substâncias químicas: ácidos orgânicos, açúcares redutores, polissacarídeos, proteínas e aminoácidos, taninos, catequinas, flavonoides, glicosídeos cardíacos, lactonas sesquiterpênicas, azulenos, carotenoides, esteroides e triterpenoides, depsídeos e depsidonas, derivados da cumarina, saponina espumídica, alcaloides, purinas, antraquinonas. Os resultados obtidos demonstraram que a espécie Pilocarpus microphyllus apresentou floração durante o ano todo e frutificação em onze meses, e a prospecção fitoquímica revelou a presença de 11 classes de constituintes químicos.

ABSTRACT Phenological studies aim to determine the seasonal rhythm of the plant life cycle events, as flowering and fruiting. These events are determined by different factors, such as: alternating periods of rainy or dryer seasons, solar radiation intensity, among others. Phytochemistry aims to identify the chemical constituents of plant species or to evaluate their presence. This study aimed the phenological characterization and the phytochemical prospection of jaborandi leaves. The chosen study area for the plant material assessment was the Active Germplasm Bank of Jaborandi in the Embrapa Eastern Amazon, located in the city of Belém, PA, Brazil. The chosen accessions were the following: Merck, grown in full sun and in shade; Japanese and Bonal 4, both grown in full sun. Records were taken on a daily basis for a period of 28 months (August of 2010 to December of 2012), from five plants/accession, and arranged for monthly demonstrations by record sheets containing the corresponding plant numeration and the presence or absence of flowering and fruiting phenophases. The dry weight of the samples collected from the accessions was measured at the Laboratory of Agribusiness of Embrapa Eastern Amazon, where, after the sorting and removal of impurities, the leaves were cut, weighed, placed in stainless steel trays, and dried in forced air circulation oven (FANEM 320 UP) at a 45°C for 120h. Then, the samples were weighed, crushed, and placed in plastic bags properly identified and stored under refrigeration at a temperature of 10ºC until the use. The plant extracts were prepared using 100g of dried leaves from each accession, crushed, and subjected to hydroalcoholic extraction (80% ethanol) with water bath heating under reflux for approximately 4 hours. The extracts were stored protected from light in a refrigerator until the analysis. We analyzed the presence of the following classes of chemical substances: organic acids, reducing sugars, polysaccharides, proteins and amino acids, tannins, catechins, flavonoids, cardiac glycosides, sesquiterpene lactones, azulenes, carotenoids, steroids and triterpernoids, depsides and depsidones, coumarin derivatives, foam saponin, alkaloids, purines, anthraquinones. Our results showed that the flowering of Pilocarpus microphyllus occurred throughout the year and fruiting occurred in eleven months, and the phytochemical prospection revealed the presence of 11 classes of chemical constituents.

The superoxide anion donor, potassium superoxide, induces pain and inflammation in mice through production of reactive oxygen species and cyclooxygenase-2

It is currently accepted that superoxide anion (O2•−) is an important mediator in pain and inflammation. The role of superoxide anion in pain and inflammation has been mainly determined indirectly by modulating its production and inactivation. Direct evidence using potassium superoxide (KO2), a superoxide anion donor, demonstrated that it induced thermal hyperalgesia, as assessed by the Hargreaves method. However, it remains to be determined whether KO2 is capable of inducing other inflammatory and nociceptive responses attributed to superoxide anion. Therefore, in the present study, we investigated the nociceptive and inflammatory effects of KO2. The KO2-induced inflammatory responses evaluated in mice were: mechanical hyperalgesia (electronic version of von Frey filaments), thermal hyperalgesia (hot plate), edema (caliper rule), myeloperoxidase activity (colorimetric assay), overt pain-like behaviors (flinches, time spent licking and writhing score), leukocyte recruitment, oxidative stress, and cyclooxygenase-2 mRNA expression (quantitative PCR). Administration of KO2 induced mechanical hyperalgesia, thermal hyperalgesia, paw edema, leukocyte recruitment, the writhing response, paw flinching, and paw licking in a dose-dependent manner. KO2 also induced time-dependent cyclooxygenase-2 mRNA expression in the paw skin. The nociceptive, inflammatory, and oxidative stress components of KO2-induced responses were responsive to morphine (analgesic opioid), quercetin (antioxidant flavonoid), and/or celecoxib (anti-inflammatory cyclooxygenase-2 inhibitor) treatment. In conclusion, the well-established superoxide anion donor KO2 is a valuable tool for studying the mechanisms and pharmacological susceptibilities of superoxide anion-triggered nociceptive and inflammatory responses ranging from mechanical and thermal hyperalgesia to overt pain-like behaviors, edema, and leukocyte recruitment.

Abnormal response of left ventricular systolic function to submaximal exercise in post-partial left ventriculotomy patients

Patients with heart failure who have undergone partial left ventriculotomy improve resting left ventricular systolic function, but have limited functional capacity. We studied systolic and diastolic left ventricular function at rest and during submaximal exercise in patients with previous partial left ventriculotomy and in patients with heart failure who had not been operated, matched for maximal and submaximal exercise capacity. Nine patients with heart failure previously submitted to partial left ventriculotomy were compared with 9 patients with heart failure who had not been operated. All patients performed a cardiopulmonary exercise test with measurement of peak oxygen uptake and anaerobic threshold. Radionuclide left ventriculography was performed to analyze ejection fraction and peak filling rate at rest and during exercise at the intensity corresponding to the anaerobic threshold. Groups presented similar exercise capacity evaluated by peak oxygen uptake and at anaerobic threshold. Maximal heart rate was lower in the partial ventriculotomy group compared to the heart failure group (119 ± 20 vs 149 ± 21 bpm; P < 0.05). Ejection fraction at rest was higher in the partial ventriculotomy group as compared to the heart failure group (41 ± 12 vs 32 ± 9 percent; P < 0.0125); however, ejection fraction increased from rest to anaerobic threshold only in the heart failure group (partial ventriculotomy = 44 ± 17 percent; P = non-significant vs rest; heart failure = 39 ± 11 percent; P < 0.0125 vs rest; P < 0.0125 vs change in the partial ventriculotomy group). Peak filling rate was similar at rest and increased similarly in both groups at the anaerobic threshold intensity (partial ventriculotomy = 2.28 ± 0.55 EDV/s; heart failure = 2.52 ± 1.07 EDV/s; P < 0.0125; P > 0.05 vs change in partial ventriculotomy group). The abnormal responses demonstrated here may contribute to the limited exercise capacity of patients with partial left ventriculotomy despite...

The effects of drugs, ions, and poly-l-lysine on the excretory system of Schistosoma mansoni

We have been able to label the excretory system of cercariae and all forms of schistosomula, immature and adult worms with the highly fluorescent dye resorufin. We have shown that the accumulation of the resorufin into the excretory tubules and collecting ducts of the male adult worm depends on the presence of extracellular calcium and phosphate ions. In the adult male worms, praziquantel (PZQ) prevents this accumulation in RPMI medium and disperses resorufin from tubules which have been prelabelled. Female worms and all other developmental stages are much less affected either by the presence of calcium and phosphate ions, or the disruption caused by PZQ. The male can inhibit the excretory system in paired female. Fluorescent PZQ localises in the posterior gut (intestine) region of the male adult worm, but not in the excretory system, except for the anionic carboxy fluorescein derivative of PZQ, which may be excreted by this route. All stages of the parasite can recover from damage by PZQ treatment in vitro. The excretory system is highly sensitive to damage to the surface membrane and may be involved in vesicle movement and damage repair processes. In vivo the adult parasite does not recover from PZQ treatment, but what is inhibiting recovery is unknown, but likely to be related to immune effector molecules.

Diagnóstico da pneumonia enzoótica suína pela técnica da imunoperoxidase / Immunoperoxidase technique for diagnosis of enzootic pnemonia in swine

Avaliou-se a técnica da imunoperoxidase como método auxiliar para a detecção de Mycoplasma hyopneumoniae em suínos naturalmente infectados. Foram colhidos 80 fragmentos de pulmões de 40 animais provenientes de granjas consideradas negativas e 40 de granjas com diagnóstico positivo de pneumonia enzoótica. Com a utilização de soro policlonal específico (IgG de coelho anti- M. hyopneumoniae) observou-se correlação positiva de 77 por cento entre os diagnósticos microscópicos e imunoistoquímicos, enquanto que a correlação entre os diagnósticos macroscópico e imunoistoquímico foi de 49 por cento. Nas granjas consideradas negativas observou-se presença de discreta imunorreação em 22,5 por cento dos casos, o que poderia indicar a existência de reação cruzada com outros microrganismos. Nas granjas com diagnóstico positivo para pneumonia enzoótica a técnica da peroxidase-anti-peroxidase (PAP) revelou diferentes graus de intensidade, variando de fraca imunomarcação até espesso depósito amarronzado no epitélio ou na luz das vias aéreas, ou ainda no interior de macrófagos, com relação direta entre a intensidade das lesões e da imunorreação. A técnica imunoistoquímica possui sensibilidade de 95 por cento e especificidade de 77,5 por cento, podendo ser recomendada como ferramenta auxiliar, rápida e de baixo custo para o diagnóstico de pneumonia enzoótica suína em laboratórios de rotina em histopatologia.

Exposición a sílice y silicosis en el Programa Nacional de Eliminación de Silicosis en Brasil (PNES) / Exhibition to silica and silicosis in the National Program of Elimination of Silicosis in Brazil (PNES)

La silicosis es la principal neumoconiosis en Brasil. El número de trabajadores registrados ocupacionalmente expuestos por más de 30 por ciento de la jornada de trabajo es superior a 2.000.000, concentrados en los sectores de industrias de la construcción, minería, transformación de minerales no metálicos y metalúrgica. El número real de expuestos es mayor pues la informalidad del trabajo actualmente es superior al 50 por ciento. El límite de tolerancia a la sílice es 0,1 mg por m3 para una jornada de 48 horas semanales y están previstos exámenes médicos y de laboratorio periódicos para todos los expuestos a sílice. Hay datos disponibles para algunos sectores como: cerámicas, minería de carbón y mármol, que apuntan a situaciones frecuentes de exposición que sobrepasan el límite de tolerancia. Hay también datos médicos sobre la ocurrencia de silicosis, que es un grave problema en actividades ligadas a la industria naval, extracción de material de relleno y cavado de pozos. El año 2001 fue lanzado el Programa Nacional para la Eliminación de la Silicosis (PNES), en consonancia con la propuesta Internacional del Programa de la Organización Internacional del Trabajo (OIT) y la Organización Mundial de la Salud (OMS), con el objetivo de disminuir la incidencia de silicosis para el 2015 y eliminarla como problema de Salud Pública para el 2030.

Reparo da luz da narina direita e oclusão de fístula oronasal decorrente de miíase em um cão (Canis familiaris)

O artigo não apresenta resumo.

Limited-sampling strategy models for estimating the pharmacokinetic parameters of 4-methylaminoantipyrine, an active metabolite of dipyrone

Bioanalytical data from a bioequivalence study were used to develop limited-sampling strategy (LSS) models for estimating the area under the plasma concentration versus time curve (AUC) and the peak plasma concentration (Cmax) of 4-methylaminoantipyrine (MAA), an active metabolite of dipyrone. Twelve healthy adult male volunteers received single 600 mg oral doses of dipyrone in two formulations at a 7-day interval in a randomized, crossover protocol. Plasma concentrations of MAA (N = 336), measured by HPLC, were used to develop LSS models. Linear regression analysis and a "jack-knife" validation procedure revealed that the AUC0- and the Cmax of MAA can be accurately predicted (R²>0.95, bias <1.5 percent, precision between 3.1 and 8.3 percent) by LSS models based on two sampling times. Validation tests indicate that the most informative 2-point LSS models developed for one formulation provide good estimates (R²>0.85) of the AUC (0-infinity) or Cmax for the other formulation. LSS models based on three sampling points (1.5, 4 and 24 h), but using different coefficients for AUC(0-infinity) and Cmax, predicted the individual values of both parameters for the enrolled volunteers (R²>0.88, bias = -0.65 and -0.37 percent, precision = 4.3 and 7.4 percent) as well as for plasma concentration data sets generated by simulation (R²>0.88, bias = -1.9 and 8.5 percent, precision = 5.2 and 8.7 percent). Bioequivalence assessment of the dipyrone formulations based on the 90 percent confidence interval of log-transformed AUC(0-infinity) and Cmax provided similar results when either the best-estimated or the LSS-derived metrics were used

Utilizaçäo de córneas de doadores com idade igual ou superior a 60 anos em ceratoplastias penetrantes / Penetrating keratoplasties with olderly donor's corneas (ò60 years)

Objetivo: devido a controversias existentes em relaçäo à importância da idade do doador nas ceratoplastias penetrantes, foi realizada uma análise dos resultados de ceratoplastias realizadas com córneas de doadores idosos (ò60 anos). Métodos: foram avaliados os resultados de 33 ceratoplastias realizadas em pacientes apresentando bom prognóstico, adequadas informaçöes sobre o doador e acompanhamento pós-operatório mínimo de seis meses. A incidência de enxertos transparentes ou edemaciados foi avaliada em dois grupos de doadores: com idade entre 60 e 69 anos e com idade superior a 69 anos. Resultados: enxertos transparentes foram encontrados em 14 dos 17 pacientes (82,3 p/cento) no grupo com idade entre 60 e 69 anos e em nove de 16 enxertos (56,25 p/cento) realizados com doadores mais idosos que 69 anos, com um tempo de acompanhamento pós-operatório médio

Frequency of the cystic fibrosis delta F 508 mutation in a population from S ao Paulo State, Brazil

Cystic fibrosis (CF) nonrelated patients (N = 24) from S ao Paulo State, Brazil, were screened for the presence of the delta F 508 mutation by PCR amplification of the deletion region with the primers C16B (5'GTTTTCCTGGATTATGCCTGGGCAC3') and C16D (5'GTTGGCATGCTTTGATGACGCTTC 3'), and by acrylamide gel electrophoresis. The allelic frequency of the delta F 508 mutation was 33 per cent (15/48 chromosomes). The genotype distribution among the patients showed 12.5 per cent (N = 3) of delta F 508 homozygotes, 37.5 per cent (N = 9) of delta F heterozygotes and 50 per cent (N = 12) of non-carriers of the mutation. The frequency observed in this study is lower than that estimated for the North American and North European population (75 per cent to 80 per cent ) and is similar to that described in Southern Europe (25 per cent to 50 per cent ) which is consistent with the origins of this population

Evaluation of some organic compounds on bloodstream forms of Trypanosoma cruzi

Accidental transmission of Chagas' disease to man by blood transfusion is a serious problem in Latin-America. This paper describes the testing of several synthetic, semi-synthetic, and natural compounds for their activity against blood trypomastigotes in vitro at 4-C. The compounds embody several types of chemical structures: benzoquinone, naphthoquinone, anthracenequinone, phenanthrenequinone, imidazole, piperazine, quinoline, xanthene, and simple benzenic and naphthalenic derivates. Some of them are for the first time tested against Trypanosoma cruzi. The toxic effect these compounds on this parasite was done by two quite distinct sets of experiments. In one set, the compounds were added to infected blood as ethanolic solution. In this situation the most active one was a furan-1, 2-naphthoquinone, in the same range as gentian violet, a new fact to be considered in the assessment of structure-activity relationships in this class of compounds. In other set, we tentatively evaluated the biological activity of water insoluble compounds by adding them in a pure form without solvent into infected blood. In this way some appear to be very active and it was postulated that the effectiveness of such compounds must result from interactions between them and specific blood components

Niemann-Pick disease in adult: report of a case surgically treated.

Os autores relatam o caso de um homem de 63 anos de idade com a doenca de Niemann-Pick na forma adulta. Os dados pre operatorios eram sugestivos de doenca de Gaucher. As indicacoes cirurgicas foram a presenca de hiperesplenismo e aumento abdominal. Foi realizada esplenectomia,biopsias hepatica e de arco costal e o estudo histologico revelou doenca de Niemann -Pick. O paciente evoluiu com empiema de longa duracao. Sao feitos comentarios sobre a natureza da doenca, a raridade da forma adulta e suas manifestacoes clinicas

Crohn's disease with exclusive gastric involvement: a case report and review of the literature.

E relatado o caso de um paciente com doenca de Crohn com envolvimento exclusivamente gastrico. As queixas principais do paciente eram vomitos, epigastralgia e perda de peso ha tres meses. As avaliacoes clinica, radiologica e da endoscopia com biopsia sugeriam rinite plastica. Com o diagnostico de cancer gastrico o paciente foi submetido a gastrectomia total.O estudo histopatologico do estomago revelou granulomas e celulas gigantes, foi feito o diagnostico de doenca de Crohn.Evoluiu bem no pos operatorio com melhora das condicoces clinicas sendo perdido para seguimento apos a alta hospitalar. E realizada revisao completa da literatura dos 46 casos com envolvimento gastrico 11 dos quais acometendo somente o estomago. Os autores concluem que o conhecimento dos aspectos clinicos e cirurgicos da localizacao gastrica da doenca de Crohn e muito importante para diagnostico preciso e um tratamento compativel com a fisiopatologia da doenca